Source: The Guardian

I am creating artificial life, declares US gene pioneer
· Scientist has made synthetic chromosome
· Breakthrough could combat global warming

Ed Pilkington in New York The Guardian Saturday October 6 2007

Craig Venter, the controversial DNA researcher involved in the race to decipher the human genetic code, has built a synthetic chromosome out of laboratory chemicals and is poised to announce the creation of the first new artificial life form on Earth.

The announcement, which is expected within weeks and could come as early as Monday at the annual meeting of his scientific institute in San Diego, California, will herald a giant leap forward in the development of designer genomes. It is certain to provoke heated debate about the ethics of creating new species and could unlock the door to new energy sources and techniques to combat global warming. Mr Venter told the Guardian he thought this landmark would be "a very important philosophical step in the history of our species. We are going from reading our genetic code to the ability to write it. That gives us the hypothetical ability to do things never contemplated before".

The Guardian can reveal that a team of 20 top scientists assembled by Mr Venter, led by the Nobel laureate Hamilton Smith, has already constructed a synthetic chromosome, a feat of virtuoso bio-engineering never previously achieved. Using lab-made chemicals, they have painstakingly stitched together a chromosome that is 381 genes long and contains 580,000 base pairs of genetic code.

- snip -

Pat Mooney, director of a Canadian bioethics organisation, ETC group, said the move was an enormous challenge to society to debate the risks involved. "Governments, and society in general, is way behind the ball. This is a wake-up call - what does it mean to create new life forms in a test-tube?"

Read more: http://www.guardian.co.uk/science/2007/oct/06/genetics.climatechange

Just asking.

Plus, we have enough problems trying to feed people and encourage them to do things. Making custom life forms isn't going to help, unless it pertains to an analogue of the photosynthesis process.

You will get one of these.

I don't. Not for a minute. By the time the rest of us catch up with what is happening it's been happening.

.

To a life form capable of reproducing itself.

All that is left is the packaging. Just like a virus, once you have the code written, delivery is the easy part. No need to evolve the packaging, just use what's available.

This could end up being really cool, or very very bad. Guess it depends on who writes the script. :)

Ever reliant on their Creator. Have they no shame? No sense of pride. They can't even make a single-cell organism, animal, vegetable or mineral.

Their postulation that life on our planet was originally created (haphazardly, of course) from a kind of chemical soup has apparently been totally disproved, so they're back to square one - or should that be zero?

There are many very unfortunate cause of undesired genetic mutations, such as Agent Orange. Thank you, but don't call us, Dumbo. We'll call you.

After you have all the chromosomes made then what? Isn't their more to an organism than just that? What for instance controls the dividing of them so that the can reproduce?
And if a virus does not have these things and just depends on invading a cell and using it's goodies to reproduce is it a living thing at all?
Just asking

once you have the code written, delivery is the easy part

Exactly the wrong way round. It's the stuff OUTSIDE the chromosome that's the hard bit.

these helps.

to make a Tyrannosaurus Rex.

Creating a perfect novel of hundreds of millions of words when you really don't understand sentences, much less paragraphs or chapters is a ways off. We are not even at the "My Pet Goat" stage and artifical human would be pushing 1000 "War and Peaces". T. Rex may not be as big, but Jurassic Park is a ways off.

Note that I'm not saying that we won't be able to put that many base pairs together fairly soon, it's just that for a long time, they will be the collected works of Coulter, O'Reilly, Hannity, Kristol, Hewitt, Ingraham, etc. In other words, a heap of utter trash.

Yeah. I am sure that is true. Unfortunately, some of those things will likely turn out to be uncontemplated by the folks making the things.

Mostly fascinating. Ok, mostly frightening. Oh, I dunno.

gacttttgagacgtagagagtttatgaccccgtatgaccacaaatttgacccgggatgccatgagacccttgtagacc

It can be translated to:

ALL YOUR BASE ARE BELONG TO US

... and injects code for producing THC into the genetic material of the bacteria that inhabit the human gut.

There would be a lot less wars when the only thing people bother fighting about are potato chips and chocolate.

We can restore some level of control and responsibility to the bioengineering fields and scientific industries in general before this bears fruit, lest it be a poisonous one indeed.

I like to think genetic engineering could have been a true boon to mankind, if not for Monsanto and their greed driven ilk. As it is, it's just one more thing to try to save the world from.

going to be just a little too clever by half, and we'll deserve what we get.

It only took 14 days of work to do it. They announced the results at a Department Of Energy press conference on November 13th.

Who - Institute for Biological Energy Alternatives (IBEA), in Rockville, Maryland http://www.bioenergyalts.org/news.html (replaced / gone) web archive link: http://web.archive.org/web/20031002162134/http://www.bioenergyalts.org/news.html



Why - Their immediate goal is to use biological engineering to generate fuel from industrial emissions (ie convert Carbon Dioxide into Methane).

What - It is a bacteriophage (virus) that is completely biologically active (it reproduces easily). The virus they created, "phi X" poses no health concerns and is considered the first step to the creation of a diverse array of synthetic geonomes that would have profound benefits.

IBEA foresees a day when, "synthetic genomics will become commonplace and provide the potential for a vast array of new and complex chemistries altering our approaches to production of energy, pharmaceuticals, and textiles." Examples of specific benefits of synthetic genomics/synthetic phi X:

-Better, faster gene synthesis.
-Faster, more accurate DNA-based vaccine production
-Improved disease therapy
-Improved biological agent detection/deterrent
-Clean energy production, hydrogen through engineered photosynthesis
-Eventual construction of "cassette-based" organisms that would replace conventional materials manufacturing

More information on the Geonomes to Life program is available at http://www.doegenomestolife.org (also replaced / gone) archive link http://web.archive.org/web/20031024043941/http://www.doegenomestolife.org/

We are NOWHERE near creating life from scratch, ie, going from laboratory chemicals to a living cell.

Dr. Venter is _stunningly_ ignorant about just how complex even "simple" organisms are.

:crazy:

I'm not buying one this yet.

by Margaret Atwood.

They said he was mad.

Not that this isn't a very important thing, but it's still a ways away from artificial life, software (DNA) is useless without the hardware to read it (gene expression and metabolism). Were can make artificial viruses, but viruses aren't living things, they are rouge bits of software that hijack the hardware of living things (like how computer viruses hijack computers). Venter has a bad habit of bombastically exaggerating things to get attention.

I do hope we will create artificial life, though. I can't wait to see the heads of anti-genetic engineering luddites and religious fundamentalists explode.

I mean, start out with a child or a college student or a postal worker, and work the kinks out, before making the droid the leader of the free world.

Sorry. Chanelling Mel Brooks. It's a reflex.