Democratic Underground Latest Greatest Lobby Journals Search Options Help Login
Google

I just got a VD in GD!

Printer-friendly format Printer-friendly format
Printer-friendly format Email this thread to a friend
Printer-friendly format Bookmark this thread
This topic is archived.
Home » Discuss » The DU Lounge Donate to DU
 
arcadian Donating Member (1000+ posts) Send PM | Profile | Ignore Thu Aug-27-09 10:41 PM
Original message
I just got a VD in GD!
:shrug: i got nothin'
Printer Friendly | Permalink |  | Top
Ptah Donating Member (1000+ posts) Send PM | Profile | Ignore Thu Aug-27-09 10:49 PM
Response to Original message
1. Is it on CD or DVD?
Printer Friendly | Permalink |  | Top
 
arcadian Donating Member (1000+ posts) Send PM | Profile | Ignore Thu Aug-27-09 11:00 PM
Response to Reply #1
2. CCCP
Old school
Printer Friendly | Permalink |  | Top
 
Ptah Donating Member (1000+ posts) Send PM | Profile | Ignore Thu Aug-27-09 11:02 PM
Response to Reply #2
3. MCMLXIX
Very old school

Printer Friendly | Permalink |  | Top
 
arcadian Donating Member (1000+ posts) Send PM | Profile | Ignore Thu Aug-27-09 11:22 PM
Response to Reply #3
4. GATTCATACGGACCTAGCATACCGTACGTA
I'm in your frickin DNA!
Printer Friendly | Permalink |  | Top
 
rug Donating Member (1000+ posts) Send PM | Profile | Ignore Fri Aug-28-09 08:15 AM
Response to Original message
5. Doesn't that usually happen in the Lounge?
Printer Friendly | Permalink |  | Top
 
jakefrep Donating Member (1000+ posts) Send PM | Profile | Ignore Fri Aug-28-09 09:52 AM
Response to Original message
6. Damn. I usually just get a headache.
Printer Friendly | Permalink |  | Top
 
coconuted Donating Member (130 posts) Send PM | Profile | Ignore Fri Aug-28-09 10:13 AM
Response to Original message
7. You got the VD in GD?
Printer Friendly | Permalink |  | Top
 
DU AdBot (1000+ posts) Click to send private message to this author Click to view 
this author's profile Click to add 
this author to your buddy list Click to add 
this author to your Ignore list Sat May 04th 2024, 04:12 AM
Response to Original message
Advertisements [?]
 Top

Home » Discuss » The DU Lounge Donate to DU

Powered by DCForum+ Version 1.1 Copyright 1997-2002 DCScripts.com
Software has been extensively modified by the DU administrators


Important Notices: By participating on this discussion board, visitors agree to abide by the rules outlined on our Rules page. Messages posted on the Democratic Underground Discussion Forums are the opinions of the individuals who post them, and do not necessarily represent the opinions of Democratic Underground, LLC.

Home  |  Discussion Forums  |  Journals |  Store  |  Donate

About DU  |  Contact Us  |  Privacy Policy

Got a message for Democratic Underground? Click here to send us a message.

© 2001 - 2011 Democratic Underground, LLC